Review



pcdna3 oct4egfp  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Addgene inc pcdna3 oct4egfp
    Pcdna3 Oct4egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 oct4egfp/product/Addgene inc
    Average 91 stars, based on 7 article reviews
    pcdna3 oct4egfp - by Bioz Stars, 2026-03
    91/100 stars

    Images



    Similar Products

    pcdna3 oct4egfp  (Addgene inc)
    91
    Addgene inc pcdna3 oct4egfp
    Pcdna3 Oct4egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 oct4egfp/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pcdna3 oct4egfp - by Bioz Stars, 2026-03
    91/100 stars
    		  Buy from Supplier
    caagcttggtaccgagctcggatcc atgggcggtaggcgtgtac idt n a pcdna3 3 oct4 neb r  (Danaher Inc)
    86
    Danaher Inc caagcttggtaccgagctcggatcc atgggcggtaggcgtgtac idt n a pcdna3 3 oct4 neb r
    Caagcttggtaccgagctcggatcc Atgggcggtaggcgtgtac Idt N A Pcdna3 3 Oct4 Neb R, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caagcttggtaccgagctcggatcc atgggcggtaggcgtgtac idt n a pcdna3 3 oct4 neb r/product/Danaher Inc
    Average 86 stars, based on 1 article reviews
    caagcttggtaccgagctcggatcc atgggcggtaggcgtgtac idt n a pcdna3 3 oct4 neb r - by Bioz Stars, 2026-03
    86/100 stars
    		  Buy from Supplier
    pcdna3 3 oct4  (Addgene inc)
    91
    Addgene inc pcdna3 3 oct4
    Pcdna3 3 Oct4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 3 oct4/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pcdna3 3 oct4 - by Bioz Stars, 2026-03
    91/100 stars
    		  Buy from Supplier
    resource source identifier recombinant dna pcdna3 egfp n a rrid addgene 13031 pcdna3 3 oct4 warren  (Addgene inc)
    96
    Addgene inc resource source identifier recombinant dna pcdna3 egfp n a rrid addgene 13031 pcdna3 3 oct4 warren
    Resource Source Identifier Recombinant Dna Pcdna3 Egfp N A Rrid Addgene 13031 Pcdna3 3 Oct4 Warren, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/resource source identifier recombinant dna pcdna3 egfp n a rrid addgene 13031 pcdna3 3 oct4 warren/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    resource source identifier recombinant dna pcdna3 egfp n a rrid addgene 13031 pcdna3 3 oct4 warren - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    pcdna3 3 oct4 plasmid  (Addgene inc)
    91
    Addgene inc pcdna3 3 oct4 plasmid
    Pcdna3 3 Oct4 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 3 oct4 plasmid/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pcdna3 3 oct4 plasmid - by Bioz Stars, 2026-03
    91/100 stars
    		  Buy from Supplier

    Image Search Results